90
|
BioTuring Inc
bbrowser v2.10.48 software Bbrowser V2.10.48 Software, supplied by BioTuring Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-215-7-10?v=BioTuring+Inc Average 90 stars, based on 1 article reviews
bbrowser v2.10.48 software - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
86
|
Eurofins
ccttcaactcctcaagatctacttgcc eurofins scientific n a primer Ccttcaactcctcaagatctacttgcc Eurofins Scientific N A Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-22-23?v=Eurofins Average 86 stars, based on 1 article reviews
ccttcaactcctcaagatctacttgcc eurofins scientific n a primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
10X Genomics
v2 10x genomics V2 10x Genomics, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-182-183?v=10X+Genomics Average 86 stars, based on 1 article reviews
v2 10x genomics - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Matsunami Glass
ipvh20200 mas coated glass slide matsunami glass industrial Ipvh20200 Mas Coated Glass Slide Matsunami Glass Industrial, supplied by Matsunami Glass, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-154-158?v=Matsunami+Glass Average 86 stars, based on 1 article reviews
ipvh20200 mas coated glass slide matsunami glass industrial - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Eurofins
paper n a oligonucleotides primer Paper N A Oligonucleotides Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-14-23?v=Eurofins Average 86 stars, based on 1 article reviews
paper n a oligonucleotides primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
10X Genomics
mas 01 chromium next gem chip g single cell kit 10x genomics Mas 01 Chromium Next Gem Chip G Single Cell Kit 10x Genomics, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-162-171?v=10X+Genomics Average 86 stars, based on 1 article reviews
mas 01 chromium next gem chip g single cell kit 10x genomics - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |