bbrowser v2.10.48 software Search Results


90
BioTuring Inc bbrowser v2.10.48 software
Bbrowser V2.10.48 Software, supplied by BioTuring Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-215-7-10?v=BioTuring+Inc
Average 90 stars, based on 1 article reviews
bbrowser v2.10.48 software - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
Eurofins ccttcaactcctcaagatctacttgcc eurofins scientific n a primer
Ccttcaactcctcaagatctacttgcc Eurofins Scientific N A Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-22-23?v=Eurofins
Average 86 stars, based on 1 article reviews
ccttcaactcctcaagatctacttgcc eurofins scientific n a primer - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
10X Genomics v2 10x genomics
V2 10x Genomics, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-182-183?v=10X+Genomics
Average 86 stars, based on 1 article reviews
v2 10x genomics - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Matsunami Glass ipvh20200 mas coated glass slide matsunami glass industrial
Ipvh20200 Mas Coated Glass Slide Matsunami Glass Industrial, supplied by Matsunami Glass, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-154-158?v=Matsunami+Glass
Average 86 stars, based on 1 article reviews
ipvh20200 mas coated glass slide matsunami glass industrial - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Eurofins paper n a oligonucleotides primer
Paper N A Oligonucleotides Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-14-23?v=Eurofins
Average 86 stars, based on 1 article reviews
paper n a oligonucleotides primer - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
10X Genomics mas 01 chromium next gem chip g single cell kit 10x genomics
Mas 01 Chromium Next Gem Chip G Single Cell Kit 10x Genomics, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbrowser+v2%2E10%2E48+software/pm36736320-131-162-171?v=10X+Genomics
Average 86 stars, based on 1 article reviews
mas 01 chromium next gem chip g single cell kit 10x genomics - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results